ID: 1172443407_1172443413

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1172443407 1172443413
Species Human (GRCh38) Human (GRCh38)
Location 20:34980742-34980764 20:34980758-34980780
Sequence CCGCCTGGACTCCTCCCCAACCG CCAACCGCAGACCCCGACCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 258} {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!