ID: 1172460635_1172460653

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1172460635 1172460653
Species Human (GRCh38) Human (GRCh38)
Location 20:35115768-35115790 20:35115821-35115843
Sequence CCCCCAGGATGCACTCCCCATAG TTGTTGTGGATGAAGTTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 115} {0: 1, 1: 0, 2: 2, 3: 21, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!