ID: 1172474516_1172474522

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1172474516 1172474522
Species Human (GRCh38) Human (GRCh38)
Location 20:35226859-35226881 20:35226873-35226895
Sequence CCCGCGCTCTGCTGCCTCCCGGG CCTCCCGGGCGCCGCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 392} {0: 1, 1: 0, 2: 1, 3: 30, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!