ID: 1172483749_1172483757

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1172483749 1172483757
Species Human (GRCh38) Human (GRCh38)
Location 20:35286781-35286803 20:35286805-35286827
Sequence CCCAGCTCCAGCCGTGCGAGCAG GCTTGATATCGGGAGACCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 130} {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!