ID: 1172511369_1172511377

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1172511369 1172511377
Species Human (GRCh38) Human (GRCh38)
Location 20:35503441-35503463 20:35503485-35503507
Sequence CCTTGAGAGAGCGAGGCCGGGAG ATGCAGGAACGGGCAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 201} {0: 1, 1: 0, 2: 4, 3: 41, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!