ID: 1172512754_1172512756

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1172512754 1172512756
Species Human (GRCh38) Human (GRCh38)
Location 20:35511956-35511978 20:35511985-35512007
Sequence CCTGGGATCTTTGCATTCATTTT CTGTCTCCACTTGTGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 350} {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!