|
Left Crispr |
Right Crispr |
| Crispr ID |
1172535284 |
1172535290 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
20:35667984-35668006
|
20:35667999-35668021
|
| Sequence |
CCATCCACCTTCGCCTCCCAAAG |
TCCCAAAGTACTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 1318, 2: 28457, 3: 107821, 4: 185067} |
{0: 8025, 1: 304317, 2: 263755, 3: 146383, 4: 128484} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|