ID: 1172583422_1172583426

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1172583422 1172583426
Species Human (GRCh38) Human (GRCh38)
Location 20:36065673-36065695 20:36065692-36065714
Sequence CCAGCGAGGGCTTCTGAGGTGGT TGGTGCCCTCCGGGGCTCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 27, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!