ID: 1172591336_1172591337

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1172591336 1172591337
Species Human (GRCh38) Human (GRCh38)
Location 20:36120158-36120180 20:36120204-36120226
Sequence CCAGGCGTGGTTATAAGTGATTC TTAATCCTCATCCTAAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 0, 2: 3, 3: 14, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!