ID: 1172602602_1172602607

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1172602602 1172602607
Species Human (GRCh38) Human (GRCh38)
Location 20:36194341-36194363 20:36194374-36194396
Sequence CCAAGATCAAGGAGCTAAAGGTA TTTCTCATACTCTCTGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 199} {0: 1, 1: 0, 2: 2, 3: 24, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!