ID: 1172639256_1172639262

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1172639256 1172639262
Species Human (GRCh38) Human (GRCh38)
Location 20:36431196-36431218 20:36431224-36431246
Sequence CCGGGATGACTGTTTGGGGGCCT CAGAGCTAGGAGATGTGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 97} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!