ID: 1172650854_1172650865

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1172650854 1172650865
Species Human (GRCh38) Human (GRCh38)
Location 20:36500431-36500453 20:36500460-36500482
Sequence CCCCCACCCGACCCCTGGCTCGA CTCCAGCTCCCCAGCAGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191} {0: 1, 1: 0, 2: 3, 3: 34, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!