ID: 1172653994_1172654011

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1172653994 1172654011
Species Human (GRCh38) Human (GRCh38)
Location 20:36525824-36525846 20:36525872-36525894
Sequence CCCCACTGATCCCCATCTGGCCC CCCACAGCCCAGGACCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 267} {0: 1, 1: 1, 2: 5, 3: 45, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!