ID: 1172662792_1172662802

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1172662792 1172662802
Species Human (GRCh38) Human (GRCh38)
Location 20:36578910-36578932 20:36578961-36578983
Sequence CCCTCAGAGCAGGAGAAGCTGAG CTGCAAGTAAGGAGGGGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 330} {0: 1, 1: 0, 2: 0, 3: 12, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!