ID: 1172668038_1172668045

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1172668038 1172668045
Species Human (GRCh38) Human (GRCh38)
Location 20:36614227-36614249 20:36614267-36614289
Sequence CCGGGTTGTGGCTTCCCAGGGGT GGTCCTGCTTTCATGTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151} {0: 1, 1: 0, 2: 2, 3: 18, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!