ID: 1172670222_1172670231

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1172670222 1172670231
Species Human (GRCh38) Human (GRCh38)
Location 20:36630043-36630065 20:36630069-36630091
Sequence CCACTATATTCTTGGGGCTGACC GCCAGAGAATGGGCCAGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 65, 4: 646}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!