ID: 1172684923_1172684929

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1172684923 1172684929
Species Human (GRCh38) Human (GRCh38)
Location 20:36746194-36746216 20:36746215-36746237
Sequence CCGTCCACCTCGGGAACTACCGA GAGAAGATGGTGGCTGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35} {0: 1, 1: 0, 2: 8, 3: 102, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!