ID: 1172684923_1172684930

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1172684923 1172684930
Species Human (GRCh38) Human (GRCh38)
Location 20:36746194-36746216 20:36746220-36746242
Sequence CCGTCCACCTCGGGAACTACCGA GATGGTGGCTGAGCCAGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35} {0: 1, 1: 1, 2: 6, 3: 57, 4: 1008}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!