ID: 1172702691_1172702695

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1172702691 1172702695
Species Human (GRCh38) Human (GRCh38)
Location 20:36862898-36862920 20:36862927-36862949
Sequence CCCGGCCGCGGACTCGGCGTCGC GCGCCAGCTCCAGGCCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99} {0: 1, 1: 0, 2: 8, 3: 67, 4: 445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!