ID: 1172702792_1172702799

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1172702792 1172702799
Species Human (GRCh38) Human (GRCh38)
Location 20:36863264-36863286 20:36863280-36863302
Sequence CCTCTCCGGGGCAGGCGCGGGTG GCGGGTGCAGGCGCGGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180} {0: 1, 1: 0, 2: 6, 3: 53, 4: 570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!