ID: 1172716675_1172716680

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1172716675 1172716680
Species Human (GRCh38) Human (GRCh38)
Location 20:36969411-36969433 20:36969447-36969469
Sequence CCTATGTAGACAAACTGCTTCAA ACTTGGCCTTGGAGTGTAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 23, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!