ID: 1172742322_1172742332

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1172742322 1172742332
Species Human (GRCh38) Human (GRCh38)
Location 20:37179010-37179032 20:37179032-37179054
Sequence CCCCGTCTCGGGCCCACCCCGAG GGCCTGGCCCAACCGCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 152} {0: 1, 1: 0, 2: 0, 3: 5, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!