ID: 1172744078_1172744085

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1172744078 1172744085
Species Human (GRCh38) Human (GRCh38)
Location 20:37193247-37193269 20:37193300-37193322
Sequence CCTAGAACAGCACCTGGCATGTG GATCTGAATTCTAAAGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 39, 3: 189, 4: 1108} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!