ID: 1172810176_1172810183

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1172810176 1172810183
Species Human (GRCh38) Human (GRCh38)
Location 20:37641740-37641762 20:37641792-37641814
Sequence CCCAGTTCTGCCACTTACTAGCT TCTGTGCCTCATTATGAGGGTGG
Strand - +
Off-target summary {0: 10, 1: 108, 2: 547, 3: 1895, 4: 4240} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!