ID: 1172872312_1172872317

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1172872312 1172872317
Species Human (GRCh38) Human (GRCh38)
Location 20:38143441-38143463 20:38143463-38143485
Sequence CCGGAGGGAGGGCCCTGCATACC CTGCCAACGCCCTGTTTGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!