ID: 1172899972_1172899976

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1172899972 1172899976
Species Human (GRCh38) Human (GRCh38)
Location 20:38327566-38327588 20:38327587-38327609
Sequence CCCTGGGTTGTTGTTTTGGCAGC GCACACAACTGGTTCCATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 272} {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!