ID: 1172919579_1172919582 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1172919579 | 1172919582 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 20:38469980-38470002 | 20:38469996-38470018 |
| Sequence | CCTTATGTGGCTTGGGCTTCCTC | CTTCCTCCCAACATGGTGGCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 22, 2: 88, 3: 169, 4: 555} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||