ID: 1172957649_1172957659

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1172957649 1172957659
Species Human (GRCh38) Human (GRCh38)
Location 20:38772526-38772548 20:38772568-38772590
Sequence CCCTCCTCCTATTTTTTCCCCTT CAGAAAGTTACCAGCATGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 140, 4: 1297} {0: 1, 1: 0, 2: 2, 3: 11, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!