ID: 1172962306_1172962310

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1172962306 1172962310
Species Human (GRCh38) Human (GRCh38)
Location 20:38807337-38807359 20:38807359-38807381
Sequence CCAGGCTGTGGGGAGATGAGGGA AGAGGCTGGGTGCAGCAGAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 57, 4: 504} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!