ID: 1172977553_1172977556

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1172977553 1172977556
Species Human (GRCh38) Human (GRCh38)
Location 20:38918329-38918351 20:38918347-38918369
Sequence CCTATGGCAACCCTGGCGTGGCC TGGCCGACGCCACCCCGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99} {0: 1, 1: 0, 2: 1, 3: 10, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!