ID: 1173125065_1173125073

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1173125065 1173125073
Species Human (GRCh38) Human (GRCh38)
Location 20:40328950-40328972 20:40328965-40328987
Sequence CCCACCCATGATTTTCTGAATCA CTGAATCAGAATGGGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 38, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!