ID: 1173165955_1173165975 |
View in Genome Browser |
Spacer: 29 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1173165955 | 1173165975 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 20:40687696-40687718 | 20:40687748-40687770 |
| Sequence | CCCCTGCCCGCCCGCGCACCCGC | CCCTCTCGCTCAAGTCAAACAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 8, 3: 72, 4: 976} | {0: 1, 1: 0, 2: 0, 3: 5, 4: 66} |
| Status | Complete | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| 29 | 20:40687696-40687718 | CCCCTGCCCGCCCGCGCACCCGC | - | 20:40687748-40687770 | CCCTCTCGCTCAAGTCAAACAGG | + | ||
| 381 | 10:132186592-132186614 | GCGGGGGCGCGGGCGGGGCCTGG | + | 10:132186996-132187018 | CCCCCGCCCGCCCGCCCGCCCGC | - | ||
| 228 | 10:34814845-34814867 | CCCCTCCCCGCCCGCGCCCCCGG | - | 10:34815096-34815118 | TCGGGCGCGCGGGCGGCTAGGGG | + | ||
| 375 | 3:111071983-111072005 | GCGGGCGGGCGAGCGGGCCGGGG | + | 3:111072381-111072403 | CCGCTGCCCTCCCCCGCGGCCGC | - | ||