ID: 1173165955_1173165975

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1173165955 1173165975
Species Human (GRCh38) Human (GRCh38)
Location 20:40687696-40687718 20:40687748-40687770
Sequence CCCCTGCCCGCCCGCGCACCCGC CCCTCTCGCTCAAGTCAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 976} {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
29 20:40687696-40687718 CCCCTGCCCGCCCGCGCACCCGC - 20:40687748-40687770 CCCTCTCGCTCAAGTCAAACAGG +
381 10:132186592-132186614 GCGGGGGCGCGGGCGGGGCCTGG + 10:132186996-132187018 CCCCCGCCCGCCCGCCCGCCCGC -
228 10:34814845-34814867 CCCCTCCCCGCCCGCGCCCCCGG - 10:34815096-34815118 TCGGGCGCGCGGGCGGCTAGGGG +
375 3:111071983-111072005 GCGGGCGGGCGAGCGGGCCGGGG + 3:111072381-111072403 CCGCTGCCCTCCCCCGCGGCCGC -