ID: 1173176988_1173177000 |
View in Genome Browser |
Spacer: 29 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1173176988 | 1173177000 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 20:40771928-40771950 | 20:40771980-40772002 |
Sequence | CCCGGGAATCTGGCAGCCACTCT | CCTCAGGAAATGAGGCCTCATGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 20, 4: 276} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |