ID: 1173193759_1173193761

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1173193759 1173193761
Species Human (GRCh38) Human (GRCh38)
Location 20:40896773-40896795 20:40896792-40896814
Sequence CCTGCACACTATGGTGTGTGCCT GCCTGTAATCCCAACTACTTGGG
Strand - +
Off-target summary No data {0: 1011, 1: 40832, 2: 167876, 3: 281841, 4: 464048}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!