ID: 1173225759_1173225771

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1173225759 1173225771
Species Human (GRCh38) Human (GRCh38)
Location 20:41161694-41161716 20:41161724-41161746
Sequence CCCAGAGGAGGTGGTCCCACCCT CCTCCTTGACACCACCTTCCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 3, 3: 21, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!