ID: 1173226028_1173226038

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1173226028 1173226038
Species Human (GRCh38) Human (GRCh38)
Location 20:41162932-41162954 20:41162971-41162993
Sequence CCCTGACCAGGTTCTGTTTCCTG TCTTGGAAGCCAGTACTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 301} {0: 1, 1: 0, 2: 0, 3: 25, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!