ID: 1173239382_1173239388

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1173239382 1173239388
Species Human (GRCh38) Human (GRCh38)
Location 20:41280317-41280339 20:41280338-41280360
Sequence CCCACCGCAATGCAACTGAATCA CAGTATTTATAGAGGGAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 34, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!