ID: 1173262706_1173262717

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1173262706 1173262717
Species Human (GRCh38) Human (GRCh38)
Location 20:41451073-41451095 20:41451125-41451147
Sequence CCTTCCTCCCTCTGGGGACTGGG TAGGGCAAGTGGATAGCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 517} {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!