ID: 1173331124_1173331134

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1173331124 1173331134
Species Human (GRCh38) Human (GRCh38)
Location 20:42077248-42077270 20:42077279-42077301
Sequence CCTTCTAGAGGCCCAAGGACCCC CCAGATTCTTCACCCCAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146} {0: 1, 1: 1, 2: 1, 3: 24, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!