ID: 1173351384_1173351390

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1173351384 1173351390
Species Human (GRCh38) Human (GRCh38)
Location 20:42248618-42248640 20:42248647-42248669
Sequence CCTGGCCACACAGCAGTGTTGAG TCGGGTCAGCAGAGTCTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 334} {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!