ID: 1173423805_1173423814

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1173423805 1173423814
Species Human (GRCh38) Human (GRCh38)
Location 20:42926075-42926097 20:42926112-42926134
Sequence CCACTGACTCGGGGCTGCCTCAA CTGTGGGTCTGACCTGCAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 25, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!