ID: 1173463607_1173463613

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1173463607 1173463613
Species Human (GRCh38) Human (GRCh38)
Location 20:43263397-43263419 20:43263442-43263464
Sequence CCCGACACACACACATAAACATC GTTTTGAGATAAACAAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 233, 4: 2368} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!