ID: 1173497951_1173497965

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1173497951 1173497965
Species Human (GRCh38) Human (GRCh38)
Location 20:43532731-43532753 20:43532778-43532800
Sequence CCAGCTTGGCCCTGGCCGTGGCA CCCACCCCTGGGCTTCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 239} {0: 1, 1: 0, 2: 0, 3: 70, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!