ID: 1173522404_1173522408

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1173522404 1173522408
Species Human (GRCh38) Human (GRCh38)
Location 20:43709784-43709806 20:43709798-43709820
Sequence CCCTCTCCCTTCTGTTTCCCCCG TTTCCCCCGAGCCCCTGACTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 181, 4: 705} {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!