ID: 1173549815_1173549827

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1173549815 1173549827
Species Human (GRCh38) Human (GRCh38)
Location 20:43924863-43924885 20:43924894-43924916
Sequence CCCTCTCCCTTCTCCACACACAG CCCGGGGTGTCCACTGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 92, 4: 943} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!