ID: 1173560857_1173560861

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1173560857 1173560861
Species Human (GRCh38) Human (GRCh38)
Location 20:44004384-44004406 20:44004398-44004420
Sequence CCTGAGGAACCCTAGATGAGAAC GATGAGAACAGAGAAGGAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 13, 3: 128, 4: 1317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!