ID: 1173570357_1173570372

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1173570357 1173570372
Species Human (GRCh38) Human (GRCh38)
Location 20:44071802-44071824 20:44071854-44071876
Sequence CCCAAAGCTGCCAGCCCTGGGTG CTGCAGCATCCTCCACCTGCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!