ID: 1173576560_1173576567

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1173576560 1173576567
Species Human (GRCh38) Human (GRCh38)
Location 20:44116006-44116028 20:44116041-44116063
Sequence CCCGCGACGGCGCAGGCGGTGCC ATGGCCATGCGCTCGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97} {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!