ID: 1173602216_1173602220

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1173602216 1173602220
Species Human (GRCh38) Human (GRCh38)
Location 20:44303950-44303972 20:44303965-44303987
Sequence CCATCTACTCCATGGCCACTCCC CCACTCCCACCACTGGTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 278} {0: 1, 1: 0, 2: 1, 3: 17, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!