ID: 1173605243_1173605255

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1173605243 1173605255
Species Human (GRCh38) Human (GRCh38)
Location 20:44326934-44326956 20:44326962-44326984
Sequence CCCCGGGACTGCGGGGCCCCGCG CAGGAGCTGGGGGCGCCCCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!